Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms10f06
Contig Information
Length 736 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms10f06   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 276
Evalue 8.37298e-23
Total Hit Count 69
Registered year 2003
Contig Sequence     [ Download ]
>rwhms10f06
CCGGGTCAGTCAATCCTTCCACATAAGTCCCTTCGATGTCAAAACTTCCGCACACTGATGCCACTTAGCCGTTCAGTCCAAGAAACTCCACCTCCTTAAA
ATTATCAATGCATTATTGAAAGATTACAACAGCATTACAACAGAAAAAACTTGTTCTCTGGTGGAGCACACCCCTAGTACACCCTACATCAACGAAACAA
AACAGAGTTACAGATATAGTTTATGTACACAACGAACTGGATGGTGCCGCGAGGCGGTGCAGTCAGTCAGTGGGCAAACAATGCAGATTCAAATCTCCTC
CCTTTGTATGCAGCACTCTACTGATGCCTCCTCACTCCAGTAGCCCCATATATCCTTAGAACTGCAATTTTTGCATATGTTGGGTACCACAGCTGTATGA
CCTGAGAGGATTCTTCTCGATCGACGGAGCTAAGATGTTAAACAAGGACTGACTACTGCTATCGGTGTTGGTGGTCACAAGCCTGGCAGGCCTTGGCCGA
TCTGGGGTTTACATATGTACACTGATCACACGTCCAAATGTTGCTATCGTCCACGCCACGGCTGGAGCTGCCTGATTTGGAGCCGGCAGCGGATGCCCTG
TTCTTACCACTCTTGCTCTTACCACCAAGGCTCTTAGAAGTAGTGTTCTTGATGCCCGTGCTTTGGCTAGTAGAAGGTCCAACGTCATTTAATCCAGTCT
CCAGTGCCCGGACAAGATTCTCAAAATAATTGCGAG
page-top