Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms10e06
Contig Information
Length 705 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms10e06   
Homology (BLAST) Top Hit hypothetical protein OsI_26204 [Oryza sativa Indica Group]
Score 494
Evalue 4.0578e-48
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>rwhms10e06
ATCCGCCCGATACAGGGGCAATTCTGGCCCAAAAACGTTGCCAGTAAACATTACATTTGGGTCGATATCAATAATATACATACATAACAGCACAATGATC
AAGTTGTACATATACACCATCTAGCGCTCTAGCTAGGCCCTAATTCATAACCTAATACTTCACCCTTCTTATCAACCACTGCCATCAGCTAGACAATCAA
CAATGTTCCTCGGGGGGGAGGCTTAGACACTCAACAATACAAGAGAAAAATTAGACTGCTAAGGTCAGTCTGCGCATCAGCTGGATTCCAGATTGAATGG
CTGCAGCAGTTGAGCAGACTTTCGCCTTCGCTTTCCTTCAGGAGTCAATCTGACTGCTGCCTTAACTGAAACCTTGCCATTTTTAGGTGGCTGCTTCTTA
GACGAATTTGGTTGTACCCGAGAGGGCTCGCCCTCTTCACCACAACTTCTTTGAGGGGACTTGACTCTCTTGCGTGCGAAACGTGCCTCCATCTCTGGTC
TACGGNTGGGACCAATCAGCTTTACATGGAATGGATTCACAGCTGTGTAGCAAACCAAGTCATTTGTAGCTTGTCCTTTGTCCAGATCAACACTTCTGCC
GNTCACCAGCTGGAGAAGGGCAGAGAATGTTCTTGCAACCTCGNACTTTGGTTTGCTGCTAACAATCTCACTGAATGATGCAATCCNTGTATCAGTTCTT
GACGA
page-top