Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms10e05
Contig Information
Length 447 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms10e05   
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195621040|gb|ACG32350.1| hypothetical protein [Zea mays] >gi|195658143|gb|ACG48539.1| hypothetical protein [Zea mays] >gi|219887093|gb|ACL53921.1| unknown [Zea mays]
Score 191
Evalue 2.15402e-13
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>rwhms10e05
ATATTTGANATGAACCCAAAGAATCNTAACTTCAGGAATACAAGAAAATCNGTACTAACATCCACACNCAAGGGGAAACCANAAAGGAGAACAAACGATG
NCTATAACCATAGGATTTGATCCTAAAGTAGATCCATAGAGGCGCTCATGCATCGCGAGTTTATTTGAATCGCAAACAAACAGGCACTCCTTGTATGTGA
TAATAAGAAGTCACAAGAGTTACATANCGCTATGGTCGCGTACTTCTTCCAATCTTCGATCGCTGAGGACCGGTTATGACANNAGAAGGCACAAAGGTAA
AAGAATGACTTTCTCTGTGAAAGTCNGCACATCCTTCANTACTCCTTCTTGCCAAANNTCTTGCACCAAAGCTGGGATGGGATTGGCCGGACTGGGTGGT
GCGGGCGTTGCTCNAGCTCGGCGGATTTCATGGCGATGGGGATGCAG
page-top