Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms10d06
Contig Information
Length 740 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms10d06   
Homology (BLAST) Top Hit hypothetical protein OsI_15282 [Oryza sativa Indica Group]
Score 526
Evalue 8.7366e-52
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhms10d06
ATCTGATTGTTTGCAGCCTCTTTAACAGCTAGTGTACACTTGACAAGAGATCTTATTGTTTGCAGGCCGGCCTCTTCAAACAATTAGTGTACACTGACCG
CCCAACTCTGCCCTGAAGCTTATCAAAGAATGGACTGCGATATGTATATAACATTACAAGGGACAAAGGGCAGATACAGACTATTGTACAAAGAATCCTA
TAGACCTAACTTACCTCAAAAGGGTTGAAACTCTACAGTGTGTGTGTGTAAACAAGATATCTAATCTGCCGATGTAATATACAGAGCATGGCGACCTACT
CGCCAACATGGAGGACTTCCTGTCGCCATTTCTTAGAAGTTCAACACTGCACAAGAAACTTTAACCGGTCATGAACCGTCATCAGAAGAGGTTTCCTGGG
AAAGCTGAGGATGCTGCAATCCATTCTCAGGCATGTTAAGTTCAAGCAATTCCTTCAACTGTTCCCTGACGGCATCTTGCTGGAGCTTCATCTCTTCAAT
AACCATGGCCTCTGCTGCCTTGCAAGATTGCTCATCTCTGAAGGCAAGGGTCCATCTCCCATCAACAAGATACTTCTTTGTCTTGCCTTTGAATTTTTCC
GGATCAAGAAAAGGAACAGTTGAAGGACGAATATTTAAATGCAACCACTTCACATGCTTTTCATCTATTCTTGGATCAGATCCAGCCAAGGGGGCAGTGA
CACGAACAATTCCACGTTGTTGTGGTAATTCTTCTAAAAG
page-top