Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms10a21
Contig Information
Length 354 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms10a21   
Homology (BLAST) Top Hit Os01g0783500 [Oryza sativa (japonica cultivar-group)] >gi|53791695|dbj|BAD53290.1| universal stress protein-like [Oryza sativa Japonica Group] >gi|113533985|dbj|BAF06368.1| Os01g0783500 [Oryza sativa (japonica cultivar-group)] >gi|215701481|dbj|BAG92905.1| unnamed protein product [Oryza sativa Japonica Group]
Score 234
Evalue 2.21308e-18
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>rwhms10a21
ATGATATGCGCACGGTCATGCGGTGGATGCTGGATACAGAGTTGCTTCACTCACATACNCAGGGACCGCCTAGGTACACAAGCCTCATGGTTTCCTTGCG
CTCCGGTTGGATGCCATTGCCTCAGTTCTCTTTGTGTGCGTCAGGCGCATCATGATACACGGGCTCATCCTCAGGCACGGTGTGCAGCTCATCTGTTGCT
GCTGCTGCCTCCCCGGGGATACCTGCAGCGTCATCTGGGTAGCGAACAACCACAACCGGGCAGACACAGTGATGCACACAGTAATCACTAACACTCCCGA
GCCTCCCCTTGCCGCCCTTGCGCGAGGCCCCGAATCCGCGGCTTCCCATGATCA
page-top