Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms10a01
Contig Information
Length 757 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms10a01   
Homology (BLAST) Top Hit hypothetical protein OsI_20584 [Oryza sativa Indica Group] >gi|125594845|gb|EAZ34904.1| hypothetical protein OsJ_018387 [Oryza sativa (japonica cultivar-group)]
Score 725
Evalue 7.56452e-75
Total Hit Count 318
Registered year 2003
Contig Sequence     [ Download ]
>rwhms10a01
GGTAATGCAGCCGTAACCAAACATATATACAAATCGAGCATCTAGGAAAGGCTGGGTAGTCAAACACCGAAACGTGGCAGCCGAGCTGAAATCACCGATA
TGAGCTACGGTCGTGACTACTACTCAGAAGCTATAAGCAGATGTAACCAAATCTACAGATGATCGGGCGGTAGTTGTACGTTAAATCATGAATACTCATT
CCACTACTCAGCATGCCTCTTGGCCATCGTCTTCTTGAGACCTTTTAGGATCTTGGAGAACCAAAGCACATTCATCACGAAGATTATGCAAGGCGCAATA
AGTACCAGAAAATAGCCGAAGGTGTTCATCTTCTTAATCTGATCATAATGTACAAACATGTGATAGAACAAGTACATGAACAGAATTATCCTTGCAACCA
GCCAAGTAACAACCATTGCAACTCCGTTAACAAGGTAAGCTTTGGAGTTCGTCATTCCAGCAACATCAAGGAACCATCTTAGATTGATTCCTGGTGTAGT
AGTCTCAGTGATGAGACCCATGTATATGTATACATGTGCTTCCCCAGAAAGCATAGCGTACATTGTAGACATAAGTGAAAGCATGTGGTGGATAACATAC
TCCATTCCACCAAGGGCAGGGTAAAGCCAATATATCATGGCAATGTCTGTAATGAAATACCCAATAGAGACCCCTAATGTAAAACTGGAGAGGCTTGAAC
TTCTAACTGTTACTGGTCCATCCAGCTGGTCAGAAAACATGCCCGAGAAGAACACTA
page-top