Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms20i12
Contig Information
Length 771 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms20i12   
Homology (BLAST) Top Hit RecName: Full=Cellulose synthase-like protein D2; AltName: Full=OsCslD2 >gi|125561155|gb|EAZ06603.1| hypothetical protein OsI_28847 [Oryza sativa Indica Group]
Score 948
Evalue 1.09227e-100
Total Hit Count 406
Registered year 2003
Contig Sequence     [ Download ]
>rwhms20i12
AAATGAACTACTAGTATGATCCAACATTTTCCAGCAACACGAAAAAAACACCTAATTAATATAACCACAGGGAACGGTCAGAATTTACTTTACTCCCCAC
CAGCTAGCCGCCGCTGCTGCTGCTGGAACAAATGGTATGTAACTCATATATGATATATGGGTACGATCAGGGGAACTGGAAGGAGCCTCCGATCTGCGAG
TTCTGCGACGGCGGGTTGATGGCCACCCACAGCAGCGAGATGGTGATGGCGAGGAGGCCGGACCAGACGAAGACGATGGTCGGCGTGCGGCCGCGGCGCC
CCATGAGGCCCTTGGCGAACGGGTACAGGTGAGCCAGCACCCAGAAGCTGAAGAAGACGCCGCCCAGGAGCTTGCTCCACTGCGGGATCTCGCTGTAGAT
GGTGCGGCTGAAGCCGACGGCGATGGCGATGAGGTTGACCATCATGATGACGATGGGCGGGATCATGAGCGAGGTCCACTTGACGATGTAGAGGTCGGCG
TACTCGTCGTTCTCGTCGTCCGCGCCCGACTTGGAGGTGAGCGTGAAGGAGATCTCGATGCCGGCGATGACCTTGAGGAGGCCCTGCAGCACGGCGGCGA
GGTGGGCGCTGGTGCCGCCGATGAGCCAGAACTGCTCGTTCCTCCACCACTCCTCCAGGTTGATGCCCGACCACTTGATCTCCAGCACCGCCAGCATGCA
CAGCGTCAGGGTGATCACCAGCAGGTAGGTGAGGAAAGGTCACGTCCAGCTCCTTGACGATGAACTGCCCC
page-top