Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms10g07
Contig Information
Length 155 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10g07   
Homology (BLAST) Top Hit Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|19569141|gb|AAL92029.1|AF486280_1 cytosolic 6-phosphogluconate dehydrogenase [Oryza sativa] >gi|7363280|dbj|BAA93024.1| putative phosphogluconate dehydrogenase [Oryza sativa Japonica Group] >gi|113594626|dbj|BAF18500.1| Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|125595798|gb|EAZ35578.1| hypothetical protein OsJ_019061 [Oryza sativa (japonica cultivar-group)] >gi|215686886|dbj|BAG89736.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 898
Evalue 6.60618e-107
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whms10g07
AGTTGGTGAGGAACACATGGATCACTGGTGTATTTTGCTTTTTAAAGATTTGCAATTTCGGTGTGTGTTTTGTATACGAAGTTGTGGATCAAGTAATTTA
ATCAAGTCCATTATTTGAGCCAATGGAATTACTGCAGATGTTGGCAAAAAAAAAA
page-top