Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms10f05
Contig Information
Length 294 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10f05   
Homology (BLAST) Top Hit Os04g0416700 [Oryza sativa (japonica cultivar-group)] >gi|38344036|emb|CAE01528.2| OJ991214_12.17 [Oryza sativa (japonica cultivar-group)] >gi|39545714|emb|CAD40930.3| OSJNBa0033G16.4 [Oryza sativa (japonica cultivar-group)] >gi|113564337|dbj|BAF14680.1| Os04g0416700 [Oryza sativa (japonica cultivar-group)] >gi|116310806|emb|CAH67596.1| OSIGBa0092M08.8 [Oryza sativa (indica cultivar-group)] >gi|125548247|gb|EAY94069.1| hypothetical protein OsI_15845 [Oryza sativa Indica Group] >gi|125590354|gb|EAZ30704.1| hypothetical protein OsJ_014187 [Oryza sativa (japonica cultivar-group)] >gi|215686964|dbj|BAG90834.1| unnamed protein product [Oryza sativa Japonica Group]
Score 280
Evalue 1.03012e-23
Total Hit Count 82
Registered year 2003
Contig Sequence     [ Download ]
>whms10f05
TGCGTCCGCGTCACTCACACGTCGACGGTGCAGTAGGACGGCTGCGTGAACTTGAGCGAGACGGTCTGCTTGCCGCCCACCGTGGCGCTCATGGCGAAGG
CACCGCCGACGGAGCCGCCGCTGGCGGAGAGCAGCGCGGGGCAGTTGACGAAGATGTGGTAGCCGCCGGAGACCCANCTGCCGACCTTCCACTTGACGCG
GCCGTCCACCTTCACGTGCAGCAGCACGTACCCGGCGGCGATGTCCTGCTTCATGGCNTCCGCCNCNTACGGGGCCACCNGNACCGAGTCCCCG
page-top