Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms10e06
Contig Information
Length 716 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10e06   
Homology (BLAST) Top Hit Os07g0517300 [Oryza sativa (japonica cultivar-group)] >gi|113611325|dbj|BAF21703.1| Os07g0517300 [Oryza sativa (japonica cultivar-group)]
Score 705
Evalue 1.42493e-72
Total Hit Count 102
Registered year 2003
Contig Sequence     [ Download ]
>whms10e06
AGCTTTTTCAGGCAAGTTATTGGCGCTCCAAAGAAGAAAACCCTTGCATCTATATTTCCTGTGGCAAAAATGGATGGTGTTGTTAGTCCTGAACTAACAA
AATATTTTGAAGTACAAATGTCTCAGCAGGAAAAACCTGATGTCTCCCAGTCAGTTCCTCTTTATGAAAAGCTTAGAGAGTCATTTGAAACTGGTGAAGT
AAATTGCCATATATCTGGAGATTTGAAGGATGACAAACAGACCAATAATTTTGATGATATTGATGGGCCAGACACCCCGAATGATCCATATGTTGACATG
GATATTGATGATGACATGCCAAGTTACTCAGATAAGATTGATGATGACGTGGTTCGAGTTACGCAGGACAGCATGGATGGACATAAAAGCCTTGATGATT
TGTGTCGATCACATCTGGATGCTCTCCTTGCTAGCATAGCTGAGGCTGAACAACAAACCGAGCTGGATGCACGAGTTTCAACATGGAAAGAGCGAATAGA
GCTTGCCTTGGAAGAGCAGGATAGAAACCCACCCTTTGATATTGGTTTATATGGAGAGCAGATCCTTGACACACTCTCGTCAAGAACTGATACAGGGATT
GCATCATTCAGTGAGATTGTTAGCAGCAAACCAAAGTACGAGGTTGCAAGAACATTCTCTGCCCTTCTCCAGCTGGTGAACGGCAGAAGTGTTGATCTGG
ACAAAGGACAAGCTAC
page-top