Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms10d18
Contig Information
Length 713 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10d18   
Homology (BLAST) Top Hit Os02g0832800 [Oryza sativa (japonica cultivar-group)] >gi|20372917|emb|CAD30022.1| N-acetylglucosaminyltransferase 1 [Oryza sativa] >gi|48716410|dbj|BAD23019.1| N-acetylglucosaminyltransferase I-like protein [Oryza sativa Japonica Group] >gi|50251412|dbj|BAD28450.1| N-acetylglucosaminyltransferase I-like protein [Oryza sativa Japonica Group] >gi|113538162|dbj|BAF10545.1| Os02g0832800 [Oryza sativa (japonica cultivar-group)] >gi|215715352|dbj|BAG95103.1| unnamed protein product [Oryza sativa Japonica Group]
Score 826
Evalue 1.31511e-86
Total Hit Count 169
Registered year 2003
Contig Sequence     [ Download ]
>whms10d18
GTCAGACAGACAGGGGGCGACTGCTCTGCCTGCAAAGGAGTCGTCTTTCTTCCCCTGCTCCGCCGCCGGCGCCGGCGATGGCGCGCAACCCCTGCGACAT
CCGCCTCCTCCTCGTGGCCGCCGCCTTCGCCTTCATCTACATCCAAGTGCGGCTCTTCTCCACCCAGTCGTCTTCTTCTAATTCCCAGGCGATGGACGGC
GGACGCCTCGCGGAAGCAGAGAAATGCGAGAGCCAGCTGCACGCCATGATCGACCAGGTCAGCGCCCAGCAGGAGAAAATCGCCGCGCTTGAAGAGATGA
AGGTACGCCAAGACGAGGAGCGTGTGCAGCTCAAGATTTTAATCCAAGATCTTGAAAAAAGGAGCTTACAGACCTTAATAAACAAGAACGTGGTTCCTGT
CGCCGCTGTTGTCATAATGGCTTGCAATCGACCAGACTATTTGCAGAGGACAGTGGAATCTATCCTCAAGTACCAGAAAGCAGTTGCTTCAAAGTTTCCA
CTATTTATATCACAGGATGGAACAAATGGAGAAGTAAAAAAGAAAGCTTTGAGTTACAATCAAATAACATTTATGCAGCATGTGGATCTTGAGCCTGTGC
GCACTGAAAGACCAGGAGAAAACGTTGCATATTACAAGATAGCTAACCACTATAAATGGGCCTTGGATGAGCTCTTCATTAAGCATGATTTCCGCCGAGT
AATCATTCTGGNA
page-top