Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms10b07
Contig Information
Length 669 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10b07   
Homology (BLAST) Top Hit hypothetical protein OsI_19874 [Oryza sativa Indica Group]
Score 858
Evalue 2.23287e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whms10b07
TTGTCTTATCCCATCTCCGCGGCTGAAGGGGATCGCAACTCCTGACTGCCCTGCTGCCCTCCAATTCCTAGGGGGGAGGTACAATAGCCTGATGGAGAAG
TACAAGCAGCAGGTGGCTAAGTGTGCCGAGGAGTGTGCACCAAGGTTCGATGGCTTGAAGAAGAAGTACACGGCGGAGTGTGCAGAGCGGCGTCGTTTGT
ACAATGAGCTCATCGAGCTGAGGGGAAACATCAGGGTATTCTGCCGGTGCCGCCCTCTAAGTTCCGATGAGATCTCCCGTGGCTGCTCATCAGTGGTTGA
GGTTGATCCGTCCCAGGAGATGGACCTTCAGTTTGTTCCCACGGAAAAAGAGAGGAAGACCTTTAAATTTGACCATGTTTTTGGACCGGCTGATGATCAA
GAGGCTGTATTTGCTGAGAGCCTGCCAGTCGTGAGGTCCGTCATGGATGGTTTCAATGTATGCATCTTTGCATATGGGCAAACTGGAACAGGGAAAACCT
TCACTATGGAAGGTGTTCCAGAGAATAGGGGTGTTAATTACAGGGCTCTTGAAGAACTGTTCAGGATCTCANAGGAGAGAAGCTCATCTGTCTCGTACTC
ATTTGGTGTGAGTATCTTGGAAGTCTATAATGAAAAAAATCANGGACCTTCTTGATGACAACTCTGAAC
page-top