Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms10d06
Contig Information
Length 693 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10d06   
Homology (BLAST) Top Hit Os04g0298600 [Oryza sativa (japonica cultivar-group)] >gi|113563974|dbj|BAF14317.1| Os04g0298600 [Oryza sativa (japonica cultivar-group)]
Score 758
Evalue 9.56619e-79
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>whms10d06
GATATCAGGTGCTCGATGCATTAGTCACCCTTTTCAGCAGGGCTAATATACCAGCAGATGTTCGCGTAGTTGGTGGCTGGCTTTTAGGCAACTGCTGCCC
CATGGAGAGGACGAGTTTACTGCTTTTCATCTAAAATTACTAAAGGATTCACACAAGGATTGCAGTGAAAAGCTGCTGGAAGAATCTGGAGGATGCTGGT
GTGACTTGCTTCTTCCTATCGTTAGAGAAGCTTGGAAAAATTGCAAGAAAGCAATTGAGGCATCTTCACCACCCAAAGGATCCAAGTCTATTATTTCACC
TTTGGAGCCGTCTTTATTTGGAGGTGATTCTTCTATCGCTATCGCGGAGAGAATCTATGAGATGGTTAAGGGTTTTGTGCTACAGCATCAAGTTATACTC
TTCTGCCTTGGAGAAACTTTCACTGATCAGCTGCCTATTTACTCTCCAGTCGATCTGCCTGTAAATAAGCGAGCAACTGCAGCAGGCTTCGATGGTTCAG
TGCCCAAGCCTGGGCTTGAAGTCAACTTAGTTGATGCAATTCCTTGCCGGATAGCATTTGAAAGGGGCAAAGAACGTCACTTCAGCTTTTTAGCTCTATC
TAATGGAACTTCTGGGTGGATTCTCCTTTTAGAAGAATTACCACAACAACGTGGAATTGTTCGTGTCACTGCCCCCTTGGCTGGATCTGATCC
page-top