Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms10a18
Contig Information
Length 697 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10a18   
Homology (BLAST) Top Hit Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|38344536|emb|CAE02442.2| OSJNBa0027P08.4 [Oryza sativa (japonica cultivar-group)] >gi|38344584|emb|CAE02431.2| OSJNBa0058G03.7 [Oryza sativa (japonica cultivar-group)] >gi|113564465|dbj|BAF14808.1| Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|125590511|gb|EAZ30861.1| hypothetical protein OsJ_014344 [Oryza sativa (japonica cultivar-group)] >gi|215694007|dbj|BAG89206.1| unnamed protein product [Oryza sativa Japonica Group]
Score 695
Evalue 1.92298e-71
Total Hit Count 188
Registered year 2003
Contig Sequence     [ Download ]
>whms10a18
CCCCATCCCTCAGGGTCTGAACCCTCTCGCGCCGCCGCCGCCGCCGTCCCCGTCCTCCCTCTCGTCGCGCCTCCGCCGGCCTTTCAGTTTAGGGTGGGAT
CATGTCTTCTGCAATGGAGTCATCGTACCTTCCTGCTACTACTGAGTCAATTGAAAAAGCTCAGGAGGCTAAGGATGCTTCAGAGTCAATTTCGATCCTT
TACCGCGTGATCCAAGACCCGTCTTCATCTGCAGATGCACTGAGAACAAAAGAGCTTGCGATTACCAACCTTACAAACTCCCTCACTAAAGAGAACCGTG
CCGAGGATCTGCGAAATCTCTTGACCCAGCTGAGGCCGTTTTTCTCACTGATTCCCAAGGCCAAGACTGCAAAAATTGTCCGTGGAATCATTGATGCTGT
CGCCAAGATTCCTGGAACATCTGATCTTCAGATCTCGCTCTGCAAGGAGATGGTGGAATGGACGCGTGCAGAGAAACGTACGTTCCTCAGGCAGCGTGTG
GAGGCAAGGTTAGCGGCCCTTCTTTTGGAGAATCAGGAGTACACTGAAGCCCTGACCCTCCTTACTGGACTTATCAAGGAAGTCAGGAGACTTGATGACA
AGTTGCTTCTTGTGGACATTGACCTTTTGGAAAGCAAACTCCACTTCTCTCTGAGGAACCTGCCTAAGGCCAAAGCTTCACTGACCGCTGCAAGAAC
page-top