Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig838
Contig Information
Length 414 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10b15    rwhdp10b15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0635500 [Oryza sativa (japonica cultivar-group)] >gi|38344804|emb|CAE03005.2| OSJNBa0043L09.24 [Oryza sativa (japonica cultivar-group)] >gi|90265181|emb|CAH67652.1| H0410G08.7 [Oryza sativa (indica cultivar-group)] >gi|113565579|dbj|BAF15922.1| Os04g0635500 [Oryza sativa (japonica cultivar-group)] >gi|218195664|gb|EEC78091.1| hypothetical protein OsI_17575 [Oryza sativa Indica Group]
Score 367
Evalue 8.22993e-34
Total Hit Count 101
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig838
CAGCAAGAAGCATAGACCATGGCAGCTCCAGCCAAGGCATCGTGGATGGTGGCGATGAGCGTGGGCACTGTGGAGGCGCTCAAGGACCAGGCCGGGCTCT
GCCGCTGGAACTACACGCTCAGGTCCATCCACCGGGCAGCCAAGGCCAACGTCCGCAGCGGCGTCTCGCAGGGTAACAAGCAGCTGCCTGCCTCAGTGTC
CGCCGTGGCCGAGAGGCGCCCAGCGGAGAAGGCCGAGGAGGGGCTGAGGACTGTCATGTACCTTAGCTGCTGGGGCCTAAATTAGGAGTGGTAGTAGCTA
GGAGTGTTGTGTTTGTTGCAGCAAGCAACTTAGTATTACTAAGCATCCATGGGCTGAGACTTGGCTCTGGTTGACCCCTGATCGGTTTGTAAAGATACCA
GGACGATGATGATG
page-top