Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig748
Contig Information
Length 480 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10a16    rwhdp10a16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0549900 [Oryza sativa (japonica cultivar-group)] >gi|113611472|dbj|BAF21850.1| Os07g0549900 [Oryza sativa (japonica cultivar-group)]
Score 415
Evalue 2.23649e-39
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig748
TCAAACAAAAACAAATCCAGCGACGATGTCTGGGCGCGGCAAGGGCGGCAAGGGGCTGGGAAAGGGCGGCGCCAAGCGCCACCGGAAGGTCCTCCGCGAC
AACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTGGCCAGGAGGGGCGGCGTGAAGCGCATCTCCGGCCTCATCTACGAGGAGACCCGCGGCGTCC
TCAAGATCTTCCTCGAGAACGTCATACGCGACGCCGTCACCTACACGGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTCTATGCCCTCAA
GCGCCAGGGCCGCACCCTCTACGGCTTCGGAGGCTAGATTCGTCTAGTGGTGCCAGTAGTGGGGCAACTTCCTCGTTTGCTCTGTGTCATGTGTTGTGTG
GTAGATGGGATTTACTGCTTTGGCGTGCGTCGTTGTGCTCTGTCTTGGGTTCAGTAGGCTGTGTAATACCCAAAGTATGT
page-top