Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp7h02
Contig Information
Length 757 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp7h02   
Homology (BLAST) Top Hit putative elongation factor 1 beta [Hordeum vulgare subsp. vulgare]
Score 854
Evalue 8.39481e-90
Total Hit Count 430
Registered year 2003
Contig Sequence     [ Download ]
>whkp7h02
CTCCTCGCCTCCCCGCGGCCACACCTCGACTCGCTCCCTCGAGATCATCTGTTCCATCCTTTTGAGGCTGAGATGGCGGCTACCTTCAATGTTAATGCTG
AGGCAGGCCTTAAAAAGCTTGATGGCTACCTTCTGTCTCGCAGTTACATCTCTGGATACCAAGCTTCCAAGGATGACTTGGCTGTGTATTCAGAGTTCTC
AGTTGCTCCACCATCAACTTGCACCAATGTTGCAAGGTGGTACAATCACATTGATGCACTCCTGAAGCTGAGTGGAGTTACTGCCCCTGGTCAAGGTGTG
AAGGTTCTGTCATCAGTTGTCCCTGAAACCTCAACTACTGATGTTGCTGAGGCTCCTGCAGCTGATGATGACGATGACAGCGATGTTGACCTTTTTGGAG
AGGAAACCGAGGAGGAGAAAAAGGCAGCTGAAGAGCGCGCTGCCAAAGCAAAGGCTTCTACCAAGAAGAAAGAATCTGGCAAGTCATCAGTTTTGCTTGA
TGTTAAGCCATGGGACGATGAGACCGACATGGTCAAGCTGGAGGAAGCTGTCCGAAGCATCAAGATGGAGGGCCTTCTGTGGGGTGCTTCCAAGCTCATG
CCCGTTGGATATGGCATCAAGAAGCTCCAGATTATGATGACCATCATTGATGACCTCGTCTCTGTCGACACTCTTATTGAAGACCATCTCTGCGTTGAAC
CAGCCAACGAGTACATCCANAGCTGTGACATTGTTGCCTTCAACAAAATCTAAATCT
page-top