Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig64
Contig Information
Length 730 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl9e05    rwhfl9e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Physcomitrella patens subsp. patens] >gi|162668702|gb|EDQ55304.1| predicted protein [Physcomitrella patens subsp. patens]
Score 310
Evalue 9.38856e-27
Total Hit Count 12
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig64
gaggatttcggaggaggatcagttcgtgatgcaagggtgatcgatcgccagccagcagcgtggttattttgtcttgtgccgagccgagcgagggagtgag
tccgtgtcggagcatcnagcatcacaggggaaggagggtggaggctgaggcagcggtgaagatatagggaagTGTGTGGAAGGAGGagggcgtGGAGTAG
GGTTGCGAGGGAGGAGCCATgtttcgaGTGCGTGCAGCTtccttcTTCACGGGATtcnccgTGGCTTCGGGCATtgctaTGTTCCAGCTTcagagGGACG
TGTGGGGCAGCCACCACATTCTTGCCGATGAGGCGGAGAGATATTATTCGCAATtagagaaacggatacaacatcttgagcgcgtgacaggtgttggtgc
cccatcttctcaacntactcaagctgatcaattcgattgatgcatcatatttactttttacactttactatgccgaaggcttctggaaacgccttacttg
ttataaagtggtgttttggcatcacaagagagatttttgtcgggttgtgtagaccgtcgttttgcatgtttccagtttccttctcattgtagtcgccatt
gcacaccctcttttaaatctgaaattggtcttgtnccttnggatttctactcatggagatagtgatgaatgctgctctgcaaatgggaatttagtccata
ttgctggcatggttgaatatgtaaggatac
page-top