Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig665
Contig Information
Length 259 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp5j06    rwhdp5j06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 135
Evalue 6.72498e-07
Total Hit Count 71
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig665
CAGAAGAGGAACAGCGTCCCGCTGGAGAAGGCTGTTTCCAAGGAAACAAGCAGAGACTATGAAGATATGATGCTTGCACTTCTGGGGGCAGAGTACTGAG
GCATGTGCCTGATCTACCATATGCTTGATGATGGGGGAATAAGAGTGCATAAAACTGTCGAGTGTGTTGTTTTTCATGGATGATTATAAGTTAGCCTGCA
TGGCAGTACTCGTCCGATGAATTATATCATTTCGTCATTTGAGCTGCAGAAAAAAAAAA
page-top