Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhkp16h08
Contig Information
Length 770 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkp16h08   
Homology (BLAST) Top Hit hypothetical protein OsJ_024137 [Oryza sativa (japonica cultivar-group)]
Score 495
Evalue 3.68706e-48
Total Hit Count 279
Registered year 2003
Contig Sequence     [ Download ]
>rwhkp16h08
AATATGAATCCATTACAATCACTTGGCTTTTACAAATCAAGGATAAAACTCAATGACAATACGGAATGATCAGAGTTTACATATAGGATACAAATATGTT
TCTTTGCACTAACTTTTTTTCCTTAGCATGGCCAACTCAATATCACCATGTGTTAACATGCCAAAACTTCTCTCGGGCTTCGGGCACCGGTCATCATCAT
TTGCTACTTCTCTTTACATCGGAACTATGGAGGCGAATAACACAGAACCATAACCTAAACAAAACGCTAGGACAAAGCACATTTCAGATGTTTCTGGTAA
GGGCATAAGGCTCCTGTCATGCCGCCTTATTGGTTTGGCTTCAGGGCGGCATTCGGCCCCAGTCCAAGCCATGGCTGGTTCTCAAACTCCTTCTTGACTG
GTGTTGCATCAGAAGGAGAAGCTTGATATGGTGCCTTTGCATGCAGACGATCCTTTCTCTTCTCAAGGAATCGGTGAAGTGACGCCTTTCTAGCAATTGG
CAGATCAGAAGCATTCGGACGAGCAGACTTAGGAGCAACAACCGGATCACTAGGCAAACTACTTGCCGGGGCCAGCACGGCCGTCTGGACCTTGGCGGTG
TCTGCAGCAGTTGTGGTCGCAGAGACGTTCTGAGCAACCGGGCTGCCCTTGCCAGCCAACTGCATCAGGCCCTTGGCCTTGTCGGCTGGGAAATCGTTGA
ACACNANCACCTTCCCACCATANAANATGGTCANCTGGCTCTTGTCTTCCTCCCTANNANCGNCAGGGGC
page-top