Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp16h08
Contig Information
Length 711 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp16h08   
Homology (BLAST) Top Hit pnFL-2 [Zea mays] >gi|195640898|gb|ACG39917.1| pnFL-2 [Zea mays]
Score 385
Evalue 1.78533e-35
Total Hit Count 106
Registered year 2003
Contig Sequence     [ Download ]
>whkp16h08
CACGAGGAAGGCGAGCCAACCACCACCGCCGCGAGACTAGCACCACGAGCGAGCTCGGCCGATTCCGATTCCGTCTGCGCTATTAAGGTTTGTTTGGAGG
AAGGGGAGGAGGTTCGGAGGTGGAGCTGAGAGAGAGACCGGAGATGGCGGCTTCCGCGAGGCAGGGGGAGAGGGCGACCAGCTTCGCCATGGCCTGCAGC
CTGCTCAGCCGCTACGTCCGCCAGAACGGCGCCGCCGCGGCCGAGCTCGGCCTCGGAATCAACAAGGGTGAGGCCGAGGCTCACAGGACGGCGGACACCA
AGAGCCCTTTGCCTGGGGCGGAGGGCGAGGAGGCCGGCAGGAAGAAGGAGACCATGGAGCTCTTCCCGCAGAGCGCCGGCCTGCAGGACGCCGCCGCCCC
TGACNCTACTANGGANGAAGACAAGAGCCAGCTGACCATCTTCTATGGTGGGAAGGTGCTCGTGTTCAACNATTTCCCAGCCGACNAGGCCAATGGCCTG
ATGCAGTTGGCTGGCAAGGGCAGCCCGGTTGCTCANAACGTCTCTGCNACCACAACTGCTGCANACACCGCCAAGGTCCANACNGCCGTGCTGGCCCCNG
CAANTANTTTGCCTANTGATCCNGTTGTTGCTCCTAANTCTGCTCNTCCNAATGCTTCTNATCTGCCAATTGCTANAAANGCNTCACTTCACCNATTCCT
TNANAANANAA
page-top