Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp2a09
Contig Information
Length 215 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp2a09   
Homology (BLAST) Top Hit hypothetical protein LOC100217128 [Zea mays] >gi|194697804|gb|ACF82986.1| unknown [Zea mays]
Score 319
Evalue 3.02598e-28
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whkp2a09
CCCTATCGTCNAGATGGACGGCGATGAGATGACCACAGTATTCTGGCAGTCTATCAAGGACAAGCTTATCTTCCCATTTTTGGACTTGGACATTANGTAC
TTTGACTTGGGAGTTCTACACCGTGATGCAACTGATGACAAGGTTACAGNGGAGGCTGCAGAGGCTACTCTCNAGTACAATGTGGCTATTANATGTGCNN
CCATTACTCCNNATG
page-top