Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp18o07
Contig Information
Length 289 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp18o07   
Homology (BLAST) Top Hit ankyrin repeat domain 6 [Mus musculus]
Score 78
Evalue 2.73957
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>whkp18o07
CGATCTGACCGGCTGGCGTCTCAGATCTGCTGCTGGTCTGATGCTAAACGGCGGATCTANATGTTCCCGGCGGTCTCGGTATGTTGCAGCGGCGGGCCCG
GAGGGGCTCTCTCCGGCGAGTACGTGGGATCCCGTCTGCTCCTCCACCTCGTTGCGACGACGGCCGACGGCTCTTTGTGTTGATAATTATTCGATGCTAT
GTCGATAATTATTANATCTAANAGATCGGAGGTGACGTAAGGTAANAANATGTATCAAGCNAGGTGCTTGTGGANAGGTCGNAGGAGAG
page-top