Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig605
Contig Information
Length 513 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10b13    rwhdp10b13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07171 [Oryza sativa Indica Group]
Score 114
Evalue 0.000213591
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig605
GGAGTATCTGCCGATGTGGTTAATGCACTTGTGAAAGATACAAATGAGCTATCTTTTGTTGATGCTGTTGCGAAGCCAGTTACTGTCTCAGATTTGACAA
AGGATGGTTCAGGCACAAAGCAAAGCATCATTTGAGCTTGTGTGTTGCATGAGATTGAACATTTGTTGGGCGATTTGTGCTGTGTTAGTGCGCTCCCATT
CTCCCATTCAGAATTCTGAGCCTGATGCCTATTTTTATGAGCGCGTTGAAATTCACTGCTTGCTATTTTCTACATGCAAGTCCGAGTAGGGTCTTGAGTT
TTCGTCATTTGTGAAGTACCACTTCGGTTTTAGTGTGACCTGCCATATTTCTTTGTAATAATTTTGTTCTTAATGTTTGTTTAGTCTCGTAACAATAATA
GTATCCCTATAGGAAGAAGCCTTCCGTGTTCTCACAGTTCTGTAATATTCATTCTATTGCCGTCCATTACAGTGGCTGTTATGCATTTCAACTTTTGGTC
CTCAAAAAAAAAA
page-top