Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig63
Contig Information
Length 543 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhfl9a17    whfl9a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=40S ribosomal protein S27; AltName: Full=Manganese efficiency-related protein 1 >gi|14140095|emb|CAA59732.2| putative zinc finger protein [Hordeum vulgare subsp. vulgare] >gi|14495006|emb|CAC42134.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare] >gi|14495008|emb|CAC42162.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare] >gi|14495010|emb|CAC42163.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare]
Score 403
Evalue 7.68722e-38
Total Hit Count 349
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig63
ctctacccccctCGCCGCCGCCGCCTCTTCGGATCGTCCCTGCCGGAGACCAGAGAGCGCGGTGCCCGAGCAAACCCTAGCCTCCCACGATGGTGCTGCA
GAACGACATCGACCTGCTGAACCCGCCGGCGGAGCTCGAGAAGCTCAAGCACAAGAAGAAGCGCCTCGTCCAGTCTCCCAACTCCTTCTTCATGGACGTC
AAGTGCCAGGGCTGCTTCAACATCACTACTGTGTTCAGCCACTCACAGACCGTCGTGGTGTGCCCAGGCTGCCAAACGGTGCTCTGCCAGCCAACGGGTG
GCAAGGCCAGGCTCACCGAGGGTTGCTCCTTCCGCCGCAAGGGCGACTAAACAGAAGTCTATCTTTAAAAGCAAGCCGATGTTGAACTCTAgtttttcag
gggtgttggtctgaaaattttgcaatgtctggcaaattgaatccatctttggtaatttggtatctagctcgagcaatattccgtttgggctgtgagatca
gactagtagtacctgccaggtaatatggtggtctgatgaattg
page-top