Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp10d17
Contig Information
Length 344 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp10d17   
Homology (BLAST) Top Hit Os09g0422500 [Oryza sativa (japonica cultivar-group)] >gi|75322910|sp|Q69P51|CESA9_ORYSJ RecName: Full=Cellulose synthase A catalytic subunit 9 [UDP-forming]; AltName: Full=OsCesA9 >gi|171769930|sp|A2Z1C8|CESA9_ORYSI RecName: Full=Cellulose synthase A catalytic subunit 9 [UDP-forming]; AltName: Full=OsCesA9 >gi|50725884|dbj|BAD33412.1| putative cellulose synthase [Oryza sativa Japonica Group] >gi|50726124|dbj|BAD33645.1| putative cellulose synthase [Oryza sativa Japonica Group] >gi|113631440|dbj|BAF25121.1| Os09g0422500 [Oryza sativa (japonica cultivar-group)] >gi|125563759|gb|EAZ09139.1| hypothetical protein OsI_31409 [Oryza sativa Indica Group] >gi|125605739|gb|EAZ44775.1| hypothetical protein OsJ_028258 [Oryza sativa (japonica cultivar-group)] >gi|215768120|dbj|BAH00349.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 352
Evalue 4.59482e-32
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whkp10d17
GGTGCTGCNACCAGGAGCGGAAGCAGTGGTCGGCCATCNCGTCTGACACCCCNCTGGAGACCGTTGGACATCATGCAAGCCATGGTGACTGCAAGTTGCT
AATTTTGGGCTCCGTGGGATTTGATGAGGTTGCTGCTCCTCTTAAAGATCGACTTGTGATGTTGAGAAGATTACCATGTTGAAGGATGGACAATTAGAGA
GGAGTATTCTCACCANATGCGTATGGAAGAAAGAAAACAAGTGAAGAATGCTTATGTCANGTTGAGTTGAGCAAGGCATGATGGTCATANTTTTTGCAAG
GCGTATCTTCAATGTNCACATGNTGTTATCCTAGGCTTATGTCG
page-top