Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp10a06
Contig Information
Length 358 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp10a06   
Homology (BLAST) Top Hit photosystem II CP43 chlorophyll apoprotein [Festuca arundinacea] >gi|215882315|gb|ACJ70745.1| photosystem II CP43 chlorophyll apoprotein [Festuca arundinacea]
Score 250
Evalue 3.07624e-20
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whkp10a06
AGAATATATGACCCACGCCTCCTTTAGGCTCTTTAAATTCCGTGGGTGGCGTAGCTACCGAGATCAATGCAGTTAATTATGTCTCTCCTAGAAGTTGGTT
ATCAACTTCTCATTTTGTTCTAGGATTCTTCTTTTTTGTGGGCCATTTATGGCATGCAGGAAGAGCCCGAGCTGCTGCAGCAGGTTTTGAAAAGGGAATC
GATCGTGATTTGGAACCTGTTCTTTACATGAACCCTCTTAACTAAGATTTTCTTATTTATACCTGTTCTACTTTTTTTCTGTCCTGGCTCGGTTATTCCA
TCTAGCCGAGCCATTCATTCCTTTTTATGAAAGAAAGATAAGGGACAGAAAAAAAAAA
page-top