Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp10a09
Contig Information
Length 480 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp10a09   
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_129081 [Branchiostoma floridae] >gi|210095105|gb|EEA43275.1| hypothetical protein BRAFLDRAFT_129081 [Branchiostoma floridae]
Score 78
Evalue 2.68473
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whkp10a09
TTCACATACACACCCACTTTTATGNTGGCNACNTATTAGTTACACTGATGCACTACTCNAGCTTTGCTTTCCTTATATGGAAATTTCATCCATGAAGTAT
GTTGTACCAGCCCTATGGCTTGCTGAATATTGCTCTTACTAATCCATTGATGCTATGCATATTCCACTTCGCCTGTCTGGGGTAAACTGAAGGATGTGTC
GTTAGCTGATGAGGTTATCCCCACTAAAGCCAAGAAGGTCAGGCGCAACTAAAACCAGGAAGGCCAATTGTTGTTAAGTGCTCGCCCTTTTGGACCTTAT
CATTTTGTTTGTGGATGCGCGAAAGAATGATGTCTGGATATGGGAGTGTCTCTTTAGATGTAGATATAGATGGTACCTGAAGCAACTAAACCGCGTATGG
GGATTTAACATTGTCTTTGGTGGAAAAGGCCCTCAATTCTCGGCCACTGTTCTATTTTTGATTTCTTGCTTGGTCGNGTA
page-top