Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp10a18
Contig Information
Length 118 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp10a18   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera] (no hit)
Score 79
Evalue 6.58302
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whkp10a18
TGCGTTTTTTTATTAGCGCACACATGGACTCTAACATTCGATAGTTGATCTTTATTTATTCACTCAACGTTGTGTTAGCCATAGACCTCTCTCTCTCTCT
CTCTCTCTCTCTCTCTCT
page-top