Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp10b17
Contig Information
Length 829 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp10b17   
Homology (BLAST) Top Hit calcium-dependent protein kinase [Triticum aestivum]
Score 807
Evalue 2.7863e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whkp10b17
CCGAGATTTCATTCTTGCCCGTGTGTATTAGTCGCTCTCACGATTGGGGGCGACGCTAATCGCGGTGCCACCACTTCCAATCCACTCTCGCGGTCGCCGT
GCCGAGCTGTTATTGCTCTGTCTTCAACTACTCCAAGATTTGTTCTTTAGACGCCTGCAGCTTCGGTGCGCAGGGACGGCGGAGAGCTCGGGACTTGGTT
CAGAGCTTAGGATCTTTGTCGATTCAGGTTTCGATTGGTTTCGTCTGCTCGGCTGACTGGGTTGTAAATTTGGAACTGAAAGGAAGAATTTGAGCACAGA
TGGGCCAGTGTTGCAGCAGAGCTACGTCCCCGGATTCTGTCCAAGGAGGAGCCAATGGCTATGGCTATTCTCACCAGCCAAAACAAGCACAAGCACCTCC
TAGTTACAACAATGCTCAGCCACCACCACAAGCTGAGGTGAGGTACACACCGCCAGCGATGAACCCTCCTGTAGTCCCACCTGTGGTTGCCCCCTCAAAG
CCCATGCCGGACACGATTCTCGGCAAGCAGTACGAGGATGTGCGCTCTGTCTACTCCCTTGGCAAGGAACTTGGTAGGGGGCAGTTCGGGGTGACGTACC
TTTGCACTGAGATTAGCACTGGCAGGCAGTATGCTTGCAAGTCCATATCCAAGCGCAAGCTCGTGAGTAAGGCTGACAAGGAGGATATCCGCAGGGAGAT
CCAGATCATGCAGCACCTATCTGGGCAGCCAAACATAGTGGAGTTCTGTGGAGCATATGAGGACAAGGGCAGCGTGCATGTCGTGATGGAGCTCTGTGCA
GGCGGGGAGCTGTTTGATCGGATTATTGC
page-top