Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whkp10b03
Contig Information
Length 110 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp10b03   
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Triticum aestivum] >gi|132065|sp|P11383|RBL_WHEAT RecName: Full=Ribulose bisphosphate carboxylase large chain; Short=RuBisCO large subunit; Flags: Precursor >gi|344053|dbj|BAA00146.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (H-type) [Triticum aestivum] >gi|13928213|dbj|BAB47042.1| RuBisCO large subunit [Triticum aestivum] >gi|61378606|gb|AAX44940.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Australopyrum pectinatum] >gi|169666638|gb|ACA63887.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Triticum aestivum] (no hit)
Score 2467
Evalue 0
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whkp10b03
TATTATAGTTCTTCTGCTTATGATGATTTACCAATCGTTCTGGACAATATACACCCATCCATGTGGAGTGTATGCTGTAAATAGTCATTTAAATCTTTCT
AAAAAAAAAA
page-top