Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg19p14
Contig Information
Length 783 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg19p14   
Homology (BLAST) Top Hit elongation factor EF-2 [Pisum sativum]
Score 1206
Evalue 1.36555e-130
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg19p14
AGGGCGACAGGGATGGGGATGAATACCTGATCAACCTTATTGACTCACCTGGTCACGTTGACTTCTCTTCGGAAGTGACAGCTGCTCTTCGTATCACTGA
TGGTGCTTTGGTGGTGGTTGACTGTATTGAGGGTGTCTGTGTGCAGACCGAAACTGTGCTGCGCCAAGCTCTTGGTGAGAGGATTAGGCCTGTCCTCACC
GTGAACAAGATGGACAGATGCTTCCTTGAGCTTCAAGTGGAAGGTGAGGAAGCATACCAGACTTTCTCCCGTGTCATTGAAAATGCCAATGTCATCATGG
CAACATATGAAGATGTGCTCCTTGGTGATGTCCAAGTGTACCCGGAGAAGGGGACTGTTGCATTCTCTGCTGGTTTGCATGGGTGGGCTTTCACCCTTAC
AAACTTCGCTAAGATGTATGCCTCCAAGTTTGGAGTTGATGAGGCGAAGATGATGGAGAGGCTTTGGGGTGAGAACTTCTTTGACCCAGCCACAAAGAAA
TGGACCTCCAAGAACACTGGGACAGCTACCTGCAAGAGAGGTTTTGTTCAGTTCTGCTACNAGCCAATCAAGCAAATCATCNCCACCTGCATGAATGATC
ANAAGGATAANTTGTGGCCTATGTTGAANAANCTGGGTGTGACCATGAANAATGATGANAANGACTTGATGGGCAANGCTCTCATGAANCGTGTGATGCA
AACTTGGCTGCCTGCCANTCNNGCTCTGCTTGANATGATNATATTTCACCTTCCCTCTCCCTCAAANGCACANANGTATCGNG
page-top