Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg20c23
Contig Information
Length 673 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg20c23   
Homology (BLAST) Top Hit vacuolar proton-inorganic pyrophosphatase [Triticum aestivum]
Score 831
Evalue 3.08342e-87
Total Hit Count 398
Registered year 2003
Contig Sequence     [ Download ]
>whhg20c23
CGTCCACCCCTCACCCGCCGCCGTCCCGTCCGTTCGGTCCGTTAGGGTTTCGTCGGCCATGGCGATCCTCGGGGAGCTCGGCACCGAGATCCTCATCCCC
GTCTGCGGGGTCGTCGGCATCGTCTTCGCCATCGCGCAGTGGTTCATCGTCTCCAAGGTCAAGGTCACCCCCGGCGCCGCCGCCGCCGGCGGCTCCAAGA
ACGGCTACGGCGACTACCTCATCGAGGAGGAGGAGGGCCTCAACGACCACAACGTCGTCGTCAAGTGCGCCGAGATCCAGACCGCCATCTCAGAAGGAGC
AACATCATTCCTTTTCACCATGTACCAGTATGTTGGTATGTTCATGGTCGTCTTTGCTGCGGTTATCTTCGTCTTCCTTGGGTCAATTGAGGGATTCAGC
ACAAAGGGCCAGCCCTGCACCTACAGCACGGGCACCTGCAAGCCAGCTCTCTACACCGCCCTCTTCAGCACTGCATCTTTCTTGCTTGGAGCCATCACAT
CTTTGGTGTCTGGTTTCCTTGGGATGAANATCGCCACATACNCCAATGCTAGGACGACCCTGGAGGCAAGGAAGGGTGTTGGGAAGGCATTTATCACTGC
TTTCCGCTCTGGTGCANTCATGGGCTTCTTGTTGTCATCAAGTGGGCTTGTGGTTCTTTACATCACCATCAAC
page-top