Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig62
Contig Information
Length 642 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl50d17    rwhfl50d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0501000 [Oryza sativa (japonica cultivar-group)] >gi|56201801|dbj|BAD73251.1| unknown protein [Oryza sativa Japonica Group] >gi|113532663|dbj|BAF05046.1| Os01g0501000 [Oryza sativa (japonica cultivar-group)]
Score 412
Evalue 1.07938e-38
Total Hit Count 41
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig62
ctAGCAACCCAAATCCTCGATCCAAATCGCCACAGATCCGTCCAGCAGGAGGTGGGAAGGGGGAAGATGGACCATCACCACCCGCCGCCGCTCCCGCAGC
AGCACGGCGACCACTACCGGCCGCTGGTGCTCTCCCCGCAGCCCGACCATGCCCACGCCCTTCAGTACCAGCAGCCGCAGCAGCAAGCGACGCCGCCGCC
GCAGCACCACCACCCCTCGCTCGCGTCCCATTTCCACCTCCTCCACTTGGTGACAAGATTAGGTGATGCGATTGCAACAGGCACAAGGGATCAAGCTTTT
GATGCATTGGTTGAAGAATTGACCAGTCAATTTGCCAGGAGCCAGCAGTTATTGAACTCCATTTCAGGAACACTAAGCTCGAAATCTGTTACGGTTGAAG
GACAAATGCAAAGTTTGGAAGAAACCCGTCAGCTGCTTGATCAAAGAAAGGATTTGATCGCAAAATACAAAAGCTCGGTGgaagacctcctcaaggggga
tccaacaagataaaaaggctctgacagtcggaccctcagaacattagttatgatgtactagctcgttaccaccaccgcctgaaataaattcctgatcgac
acgtcttatcatgtaaacatgcttggagtagtctgggagtaa
page-top