Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg8f07
Contig Information
Length 829 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg8f07   
Homology (BLAST) Top Hit hypothetical protein OsI_37599 [Oryza sativa Indica Group]
Score 437
Evalue 2.2492e-41
Total Hit Count 158
Registered year 2003
Contig Sequence     [ Download ]
>whhg8f07
CCCTTTGGAGCACAAACTTCTCCATTCGGCTCTCAAACAGCTGCACCAGCATTCGGGCAAACTACGTTTGGAAGTCAATCTGGAGGAACCAGAATACAGC
CTTATGTACAAACACCTGATACTGACACTGCTGCAAGTGGTTCTCAGCCTGCTGCAAAACTTGATTCCATATCAGCCATGCCTGCATACAAAGAGAAGAG
TCATGAAGAATTGAGGTGGGAAGATTATCAGCGTGGGGACAAAGGTGGACCAAACTCTTCTGNAACTCCAGCAGTGAACAACTTCTTATCTCCACAGCCA
AGTTTCCAACCAAATCAACCAGCACCAGTGAATCCATTTACTAACCCCTCACCCTCACCTTTTTTGAGTGCTTTTGCTACTACTCCGAACCCGTTTTCAT
CGCCCGCAACTACTACCTCCTCGTTTGGACAAACAAGTGGTTCTACATTCCCAGCAAACACTTCATCTTCTCTATTTGGAAATAATACCACCACTTCACT
ATTCAACAACCCAAATCCTTTCAATGTTGGGTCATCCACTAGTAATAGCACTCAATCATCTGGGCTGTTTACGTCTTCCCCTACAATGGGGCAGCAGCCA
TTTGGCCACTCATTTAACCAGCAATCAAGCACTCCAGCTTTCTCCACCAGTATGTTCAATACATCTAACATCGGAATCACTGGAGGTGGAGGGATGTTTG
GCAACACATCTTCACCTTTTCAAACATCATCATTTCAACAATCTGCCCCTGTTCAACCTACAAACTCGTTCTCATTCCAACCTCAGACTCAACCAGCTTT
GACAGGTGGATTCTCTGGGTGTTTCCAAC
page-top