Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg4d03
Contig Information
Length 764 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg4d03   
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 271
Evalue 3.41903e-22
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg4d03
ATAGCAGCGACGATTCCTCCTCTGACGAGGAACCTGCAAAGAAGCCTTCTGCTAAACCTGTGACCCCAGCTGCCAGCAACGGCTCAAAGAAAGGCAAGCC
TGAGAGCAGCTCTTCTAGTTCTGAGGATGAGTCCGATGATGACGAGAAACCTGCTGCTCTGGTAAAGAAAACACCAGTCATCGAATCTGACAGCTCCGAA
AGTGACTCAGATGATAGCTCAGATGAGGATGTTCCTGCCAAGACTCCTGCTGCTGCTGCCAAGAAGGTAGATTCTTCAGACAGTTCTGAGTCGGAGAGTG
AATCTGAGGATGAGGAGAAGTCAAAGAAAGCCGCACAGGCCACCAAGATAGCTCCTGCAGCTGCTAAAAGAAAGGAGGAGCCCAGTGATTCCTCAGACAG
TGATGAGAGTGATGAAGAGCCTCCCCAGAAAAAGCTGAAGGATGCTGCGAAGGTTACTCCTAAGTCTGCCAAAAAGGACAGCACCAGTGATGATGACAGT
TCTGATGAAAGCTCTGATGATGAGCCTAAAAAGAAAGTTACAACTGCCTCAAAATCACAGAAGGAAGAGCCTAAAACTCCTGCTAGCAACAAAGGTCAGG
CAACAGGGTCGAAGACCCTTTGGATGGGGAACCTTTCCTTCAATATTGAGTATGATCAAGTGAAGCAATTTTTTGCACAAATTGGAGAGGTCGTTGATGT
TCGCCTGGCTACCCATGAAGATGGCCATCCCAAGGGATTTGGTCATGTTGAGTTTGCTACGGCT
page-top