Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8e03
Contig Information
Length 741 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8e03   
Homology (BLAST) Top Hit hypothetical protein OsI_30832 [Oryza sativa Indica Group]
Score 240
Evalue 1.28439e-18
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8e03
AAGTTTGATGAAATAGCAGGAACATAGATGTGCTCAATAGTCAATACGACTATCCAGGGAGTCAGAGTTTCACCCAAGGCCCTCGTGGCCTCTCAACCGA
GGCATGCTTTGCTACTTAGGTGAGCGCCCATTTTGGCTTCTGACACAAGATAGCCCTCCTAAGAGAAACAGCAAAAGGATGCTCTGTAACAGATGTAAAA
TCTATTTAGCTCCTCTTGTTGACTGTCAAATAGCTCTCCTGTTACCAATGGCAAATTTTGCTGACAGGTTATTATGTCAATGGATGTGGAGGTGGTATAC
ACCGTAGATCATGCCTGTTCCACTAGAACAAATAACTTTCACATATCAGAAACTTGGCGACAGCAAAGGTACATCAAATAAGTGGAATAAAGGTGACATA
ATTCCACTCATTTACCTAGAGCTAACAGCCCACTGAACAAAGAACTGGGAAACAATGAGGAAGATGGCACAAAGTGTGTACTTGATCCATGTTTCCCAGC
CACCATGAACTCGCTGGGGAGCAACAGGCACCGCGAGGATAGCTGCGCCTTGCATACTGAAGCATTCCCTGCATCGTCGGCTTCTATAGAACATGCCAGT
CCTCTTGGTGTACGAAAAGTACAAGGAACCACCATGCAATTTCGCATAAACATGATCAGCTGCATCTTTGATGAGGCGCCCGTANCGCGCGGTGGATGAG
GAGCATCTGTTCAATAGGTCCTCGCTGCCGATAATCTCCAA
page-top