Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2l22
Contig Information
Length 790 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2l22   
Homology (BLAST) Top Hit RNA recognition motif family protein, expressed [Oryza sativa (japonica cultivar-group)]
Score 653
Evalue 3.4255e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whhg2l22
GGTCTCCAAGAAGGAAAACTTGAAAGAGAGGCCAAAAGATGGCTCCAAGCTGGATGAATTGAAAGATACACCAAAGGTTCCAAGGAAGGATGACCACAGA
GATGCACCAAACAAGGGCTCCAAGAAAGAGAGGTCCTCTGTAAGAGATGATAGTCAGTCAGCTGGCAAAGACAAAGATGCTCATAATTCACATAAACATA
GCACAAGCTTGAGAGGCCGGCCTGCTGAAAGCAAGGATGGAAACCATGGTGAAATCAGAGCAAGAAATGGTGATGCGACAAGATCTGACTCTCTAAAGGG
ACCGGGGAAGAGATGGAATGGCGAACCTGTTCACAATGATAGAATCATGGAGAGGAGCGACAAGCTCCGGAATGAAGCAAAAAGGAAAATCCATAGTTTT
GATGAGGAAAAGCCTTCATATGTTGATCGACCGGTGCTGAAGAAACATGATTCCGCGCGATTCCAAGTTTCCAAACACTATGACATAAATGATGCAAGGA
GAGAGTACGGAAAACCATACCGTGAAGAGCCCAGGTCAAAAAGGAGAAGGTCAAGAAGCAGGGATCATGATCAAGGAAGACGTGACAGATCTCTCTCACT
ATCCCCAAGGGAACAAAGGCGTAGCTACCATGGAAATGATCATGACAATTATCCTCCTGGAAGGAAGTATGCTGAAAACGACAGGTACAGAACATCTGAT
AATGTTGGACAAGGTGGTGGGTCTTACCAGAGATATGAAAGTCGNGCTTGGTGGCTACTCNCCAAGGAAAAGGAAAACAGTGCCACAAGA
page-top