Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2l21
Contig Information
Length 168 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2l21   
Homology (BLAST) Top Hit ethylene response factor [Malus x domestica]
Score 74
Evalue 7.8623
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whhg2l21
ATCTCTCCCCCGTCGCCTCCTCTCGATCCCTCCTTCTCCCAGCGCCCCAATGCTCGCTGCTCGATCCCCTTCGACACGCACTCCCTCGTCCTCCTCGACA
TCGCGGTCCTCCCAGCACCGCGAGCCTGCTCCGCCGCCTCCTTTCCGCCCTTCCGCCCCCCCCCCCCC
page-top