Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4a02
Contig Information
Length 853 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4a02   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 338
Evalue 7.16762e-30
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4a02
AAGAGAAAAAAGTCACCAGGTAGTTTCGGTTACGACAGACGGACAGACGGACGGTGAGGGTTGGGTTGGCACAACGAAAGGAAAAAAAAACTTTACAATC
TGTTTTGCTACTCTTGTCCAAGAGCAAGCCAGAGAGAGAACTCCATGTTGGCTCCACAATCTCTTTCTTGCATGCTAGCTCTTCTGGCACCACTTGCCCG
GGAACCAACGAAAACAGGGCTCTCGCTAGCTCAGCAGCAACTTGAATATGTCGCTCAGCGATATTACGCCTTCCACTCGCTTGCTGCCAGCCTCCACGAT
GAACACGCGACGCACCCCAGGATTAGCCAACCTCTCCATAACCTTCAGCAAAGGGTCAGACCGGAGACACATCTGGCATCTTTGACCGTTGAAAAGTCCG
AAAGGTGAATTCGCGTCTTGCCCAAGCTGCAAGGCCTGGCCACACAAGAAAGTGTTCATACTGCAGCCATGAAATCTAGGCGGGTAACAGATTTACAGAT
GCATAACTCATGAGAAAGGATGTTTGAAATTATATAGCACTATGGAACAACCAGCTCTCCCCTTGACTGTTCGGTGCAGCTTCAGCTGCAGTGCACACTG
ATTGGATATGTGGCATCAACTGACCAAGTGAAACGACGAAAGGAAAATATGTATTACTTGGACAAAGGAGCATCTATACGTAGCTCCAAACAAAGGGGCA
CTTATCACTGCCTGCCTCTGGGGCTACAAACTAACGAGGGTTTGCTTCACTAATGAATTCCAGAATCAGTTATCAAATCCACAAGGTAGTATTTTAAAAT
TTTCTATCGGGTGCACAGTTTGGTAGTTGGGATATCGATAATACTACATTCNC
page-top