Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg17n06
Contig Information
Length 774 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg17n06   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 770
Evalue 4.80946e-80
Total Hit Count 79
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg17n06
AAAAAATACTTAAAAGATGTACAGCAAGACATGAGCAAAGTAATGATATGCGGACCGCTAAGGAGAAGCTAATATCGAACAGCAGGAAAGCAGAACCGGA
CACAAACAACCTGCCTCCGTTCTCAACAATCAGTCACCTCAAACCATTTTTTACATCTAACGTATAACAAACAACGCACTATCGAAGCTTTGACTCGTTG
GTTTTGCTGCTCCGGAAGTTTGAGAGGGAGAAGAATGACCTTGATGCTGCTTTAGTTGACGGTGCAGCTCCAGGCCTGTCCCGTAGCCTATCCGAGCCTG
TGGCATTGAAGCTGCTGGTCGTTGATTGAGCTGATAAGATGCTATTAGTCTTGGAACCATCAAAAGTTCTCCTGCTGGAATTTACACCATCACTAGCACC
GGATTCTTCTTGTTCATCCTCTCCATCAGAAACCACCGATGGGCTTGCCAAACCATTAGTGTTGTTGTCTCCTTTGTTTTTCCGAGCAAATTTAAGAAGT
CTCTTGAATCCTTTTGGAGAATCTTTATGAAAAACTATTGCGGGTGGGTTTTCAGCATTTCCCCACTCTATTATTTCTGGTTCGTTGCTATCTGCTTGCA
ACATTTGTGACAACGAATGACGGATTCTTGGGCTTGAAGACGGTAACGGTTCAATTGCTGGCGAGGTGACATCCTCGCCTGTCACGCTTTCACCCACATC
AGTAACTTCTTGATGATCCACTTCAACCCAGGCAGCTGACGAGATGTCCATGTCCTCGTCAAGAGGTTTGACCT
page-top