Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4a07
Contig Information
Length 429 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4a07   
Homology (BLAST) Top Hit hypothetical protein OsI_10217 [Oryza sativa Indica Group]
Score 145
Evalue 4.61921e-08
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4a07
CGCTTCTACTACCACCACGGAAAGGGCAAGGCTTCAACGAACCAAAAGACACCACTCTAGCTCTCTTCGGCCTCATAAGCCCTGTTGTTGTTAATATCCT
TAACCCCAAAATGTTGCCTCTTAGCATCTTTGTTGTTCTCATGATCCTTATTAGGTGTCAGCTTATCATGTAAAGATGTGGCATGGCCTGTGAAAATGGA
GTAGTGTGATGTCACACTATTGGCTATCGCTATACAAAAACTTCAAAAAAATCAATGTTTCAGCATTCGTGTTGATTCTTCTAAACCGAGATTCACAATT
TCTGTGACATTCTGCAAATAAATCAATCATCCATACCCAGGATATATCAAATACTTCTCAGCGTTGAAGGCAAGAACTCCTGGAAAGGGGAATGCGGAAG
AGATCACAAACTGACGAACGGAGGGAGCA
page-top