Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8f03
Contig Information
Length 767 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8f03   
Homology (BLAST) Top Hit hypothetical protein OsJ_024892 [Oryza sativa (japonica cultivar-group)]
Score 303
Evalue 6.71176e-26
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8f03
CCCCTCTTCTACAGGTTACTTGTGGGGTTACGAATGAAAAATGTACAGCTAAACAGATATCCACTTGGATCACAAAGAGAATTTGATTCATGGGACTATC
GACAATGTTTCGGCGAGTTCCTTAGCTCTGCATGACTGTTGTAGTTAATTCTCCTTGGATGCTGTTGACACTCCAGTGCTAATGCCTCTTCTCATCTCCA
GTGGGAAACACCAACTAATTACTAGCGAGAACTTCCATCAACAGTGGGTGAAGCATAAAGATCCTATTATGCAACATTTTGCTTCAGCTCGTTTGTGATT
TCCTGGAAGGCCCGCCGGCGGTCCGGTGGCCTCCACGGTCCTGTGGTCGCCGGGCTCCCAGGGCAACGGTTAGTGTGACTGGCACCCTGAGAGCGTCCGC
TAAAACCAGATGGTACCTGCCCGTGGAAAAGCGAACGCTGAGCTGCACTGCTTCTCACTGAGCTTGCTGTTTGCTCGGTGCCTCGAGCTTTCTCACTGAG
ATGGGTCGTGTTAAGCCTTTGGCAGACTCGGTCGCCACGATCTTGAACCTTCCGCTGCTTCCATGCTGGAGCTGTCCTGACGAAACTCCGGTTCACATTC
TCGTCTGTCGAGATTCCGGCCGAGTCATTACGTCTCCATGAACCTGCTGATGAACTCTGCGGCCGAACACCAGCGACCGGGGTTTTGAGGCTGCAGCTTC
CTTGAGATGATGAGGATGGGGGTTTTATCCCTCTGCTCACTCGCATGCTTGCTGCTTTCACCTTGCG
page-top