Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg10l16
Contig Information
Length 260 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg10l16   
Homology (BLAST) Top Hit RecName: Full=Serine carboxypeptidase II-2; AltName: Full=CP-MII.2; Contains: RecName: Full=Serine carboxypeptidase II-2 chain A; Contains: RecName: Full=Serine carboxypeptidase II-2 chain B; Flags: Precursor >gi|619351|gb|AAB31590.1| CP-MII.2=serine carboxypeptidase [Hordeum vulgare=barley, cv. Alexis, aleurone, Peptide, 436 aa] >gi|6102957|emb|CAB59202.1| serine carboxylase II-2 [Hordeum vulgare subsp. vulgare]
Score 447
Evalue 4.45885e-43
Total Hit Count 231
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg10l16
GATTTGCCAATGACCGGATTAACGTGAAGTGCCTTCTGCACCTCATGCAGATTGAAATATACAATTGAATGTTGTTCAGTGCATGGATCATATTGCTCTC
CCATTTTTCCAGCAGACCGGAGCCTTTTCACCACTTTGTTCCTTGAGGAGGCAAAAGATGAATGACAAGTAGGTGTGAAGATGCTATATGAATCGATGTT
CCCAGCTTCAGTGCTAGCAATGTCAAGAATCTTATCACACTGTGGAGATGTATGCACAAA
page-top