Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4b01
Contig Information
Length 453 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4b01   
Homology (BLAST) Top Hit UDP-D-glucose epimerase 3 [Hordeum vulgare]
Score 595
Evalue 3.04112e-60
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4b01
GGAAACATTTTCTGGGCACACTTTAACGCCCTGGGCTTATTGACAACATCTTTCTTTCACGCTACAAGGCTCCCGATGGGCCACCGAATCAGNCTTTGTT
TTCAGCGTTTCCGCAGTAGCCATAGGGGTTCTTCTTGGNCCAGTTCCACTGGTCCCTGCACATCTCCTCGATCCCGTACTTGGCCCTCCAACCGAGCTCC
TCTTCGGCCTTGGCGGTGGACGCGTACACCTGCTCCGAATCGCCCGGCCTCCTGGGGCACATCTTCACCGGGATTTTCTTGCCGTATGCCTTCTCGAACG
CGCTCACCATCTCCAGCACCGNCGTCCCNCGCCCCGTCCCCAGGTTGTANGCCACACAGCCGATGTCAGGGGTGGCGAAGAGCTTNTCGAGCGCCGCGAT
GTGGCCGTCGGCGAGGTCGACCACGTGGATGTAGNCACTGACGGCGGTGCCGT
page-top