Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2l06
Contig Information
Length 738 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2l06   
Homology (BLAST) Top Hit hypothetical protein OsI_27275 [Oryza sativa Indica Group]
Score 610
Evalue 1.5885e-61
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>whhg2l06
ATAGCTCAGGTGAGCAGAGGAACCACAGTGAATCACAGCTCTGCTGCCAAGGAAACTCATAAGGATCAAAACTTAAAGGAAACAAAGTCCAAGCCAATAA
AGTCTGAAGAACTGTATTCCACGACGGATTCTAAATTAGGAAAAGGTCTGCACTCTAATCAGATTTCTTCTTATTATGGTGGTCATGTAAACAATGAACT
TGTGGAGGATAGCACACACTTTGCTGGTAAAAGAGGTCCATCCGAAGTATTAGATAAGCGATCTTCTGAACATGCTTTGGACTTAGCTGGAGCTGCTTCT
AGTGATGTTCCGACCACAGCCATAGCTTCAAGTTCTTCAAAAGCTTCAGGCTCTCAGAAAAAGAAAAATAACTCCCAAGTTGCAAAGACTTCACCGATTG
AATCAGTTTCCTCATCACCACCGAGGAACTCTAACATTGATAAGTTCTCCCAGAACAGAATAGTGGAGAAAGATGGGCCTATGAATGCTAACCCAGGCAC
CATGCCGAGCTCAGTAAAGTATCTCAATACTGAAGTTGATATAGTAGACAATGTTCGGCAGGCTAAGAAGTCCAAGGAGAGTTTGCTTGCAAGTGAACCT
GTCTTACATGGCTCTTCACAAGGAAATTCTGACAAAGATGATGAATTAGTTCAGTTAACTCAAGGCCATGCATCCGAAAGGTTTTCATTGAGAAAGGGTT
TGGATGATGATCANCAGCATGCATCTGGGAGAAAGGAC
page-top