Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2l02
Contig Information
Length 784 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2l02   
Homology (BLAST) Top Hit hypothetical protein OsJ_017967 [Oryza sativa (japonica cultivar-group)]
Score 454
Evalue 2.17806e-43
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>whhg2l02
TGCACGCCAGAAGAAAAATCTAATCAGAAACTTCGCAAGCAAATCAAGAAGCAAAAGCCTGCTGTTACAACGCCAGAAGAAGAATCTAATCAGAAACTTA
ACAAGCAAATCAAGAAGCAAAAGCCTGCTGTTGCAACGCCAGAAGAAGGAACTAATCAGAAAGCCAAGAGAAGTTATGTCCGGAAGAAAAGAAATCTCAG
CTCTCTGGAGAATTGCCCGGGACCTGTTAGCGACCAATCAGTCTCCAGGGGAGCAGAAGACGCTGTTAGAAGCAGAGCTGTATCAGTCCGAAGAAGGTTG
CAGTTGGAATTTGGTGAACAAGGAGCACTGGGAGACCAATCATCAGCTGGCAACTCATGTCTCCACATTGAGGAGAAACTCATTCATGCTAAAAGTTCTT
TCTGTTCAACTGCCACTGTATCAACTGCGCAGGGTGCACATGGACTACACGTGGACATGGAAACTTCACCAGGAGGATTAGCTTTTGGCATGAGTCGCAA
GATGAACAAACTGTTAGATGAGTACATACATTTGCCAGAGATGGGAACAAACTGTACACAAGAAGTTCCGCCTGCAACTTCTGGATGTTTTAGCAGGGAG
CCAACAACAAAACAAGACAGTGTACGAAGCACTCATGGTCTTGATGCCACAAGGATTGGGGTTACCATAATGGAAGGGTATAACAAGGGCTTGGAGGCAA
ACGACTCTAGCAAGGCTGGTTTTGCTATGCATTGCTCAGCTACGTTTATACCTGAAACAGCATCCACAGAAAAGTCAAGACTAA
page-top