Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg4b04
Contig Information
Length 582 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg4b04   
Homology (BLAST) Top Hit unknown [Picea sitchensis]
Score 83
Evalue 1.17061
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg4b04
AACATCATATGCAATTTGATCCTAAACAGCATGCAGATTAAAGGGGAAGTAAATCCGATAATTATCACATTGTGTATATCCTTAGGGTGCAATGAGCCCA
TGTTTGACGGATCCAATCTATTTGCCAGACCTCAGATATGAACCACCACTATATGTGTAGCACAGACAAACTGCTGCCTAACCAAATTCAAAAGATTCGT
GCGCGTTGCGTTGGGAGCCACCAATGAATTGACCTAGCCACACAAAGATCCCAACTGAGCCAGCAAGGGAAATATGCATCAACTGTCTATTGGCATTATT
CACTGGCTAGTGTGAAGTGCTGTGGCCCTGTTTCTTCCTTCCAATCAACGAGCCGCAATGCGAGGAATCCGTAGTTCGGAATTTTTTGCCTTGATGTTCT
TCGTCAATTCCTCAAAAGATTCAGGTATGGAGTGGTACTCATGAAACATGAGTCCTTTTGTCCACTCATGAGGATGGCAGTAGGTTAGAAGATGGTCAGC
AATGGTGAAGGGGCGCACGGAGGGTCGGATCCTATCCTTCCCATCATGTATTTGTTTTTTTTTTTTNACGGNACCNAAAANC
page-top