Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhhg8f07
Contig Information
Length 757 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhhg8f07   
Homology (BLAST) Top Hit hypothetical protein OsI_37598 [Oryza sativa Indica Group]
Score 776
Evalue 9.3031e-81
Total Hit Count 247
Registered year 2003
Contig Sequence     [ Download ]
>rwhhg8f07
GGATATGTACAGAAGAACATGGGAAGGAACTCATAGCAGCATTCAGAGAAGAAAGGCATGACAACCAATATTCTCCCAGACCAGACCAGACCAGCTACAT
CGACCAAAGCTACATGGAATCGAGTGTCCACCGTTCATCCAAAAGAAAACAAGCACCTATCGACAAAGCTACAAGGAATCGGCCAGGTCGTCGGCTTCGG
CTTCACTAAACCCGTAGGAGCTGAAGTGCTTCACCCTGAACTTCCACTCGCCCTTGGCACCGTCAAACGAGATAAACTCCACCCCCTGCTCATCAGCCTT
CTTCACCAACATCTCCTTGAACTTGTCCAACCTCGGCCCTTGCGTGTACTGCTCACCCGTCTTCTTATTCATGCACTTGATGTTCAGGAGGGTCACCAAA
GCAGCTTTGTTCAGGCCCTCGCCAACTGGGGGCTTCTTGCTATCCTCCTTGTACACAATCACTTCACGGTTATTGAATTCCACAATCGACTCCAGATCAA
GGCCCCTTACATCAGTTTCTCCCAAGAATTTGATGCTGCCATAACCTTCACGCCCAACAATGAAGTCTACAACCTGACTACAGTAGCCTGGCTCAGCACG
TTCTTTGGCAGCAAGCTCCTCTAGACTGGGCTCCGTGAAGTAATCTGCCTGGGAGAGCCTAGGCATCATCTTCTCAACGGTAGCACCATTCATATGCCGA
GCCACATCCCCAGGCTCGCTTGATGCAATGTGGATGCCATTCTCCACTGTACNAGAC
page-top