Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whhg2k18
Contig Information
Length 131 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whhg2k18   
Homology (BLAST) Top Hit wsv094 [Shrimp white spot syndrome virus] >gi|17016492|gb|AAL33098.1| wsv094 [shrimp white spot syndrome virus] >gi|19481742|gb|AAL89018.1| WSSV150 [shrimp white spot syndrome virus]
Score 79
Evalue 2.0617
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whhg2k18
CGACCTTTTATATCAAACTGTACTGTTGTTTACATGCAATCTAATGTTATAAGATGTATACATGCAACACCTGTTATCACTGTCGTGATTCGGTGAGTTA
AAATTGTCAGGATGTTCTTCGAAAAAAAAAA
page-top